Tobacco And Kids Essay Example For Students

Tobacco And Kids Essay Tobacco Ads Target YouthEveryday 3,000 children start smoking, most them between the ages of 10 and 18. These kids account for 90 percent of all new smokers. In fact, 90 percent of all adult smokers said that they first lit up as teenagers (Roberts). These statistics clearly show that young people are the prime target in the tobacco wars. The cigarette manufacturers may deny it, but advertising and promotion play a vital part in making these facts a reality (Roberts). The kings of these media ploys are Marlboro and Camel. Marlboro uses a fictional western character called The Marlboro Man, while Camel uses Joe Camel, a high-rolling, swinging cartoon character. Joe Camel, the smooth character from R.J. Reynolds, who is shown as a dromedary with complete style has been attacked by many Tobacco-Free Kids organizations as a major influence on the children of America. Dr. Lonnie Bristow, AMA (American Medical Association) spokesman, remarks that to kids, cute cartoon characters mean that the product is harmless, but cigarettes are not harmless. They have to know that their ads are influencing the youth under 18 to begin smoking(Breo). Researchers at the Medical College of Georgia report that almost as many 6-year olds recognize Joe Camel as know MickeyMouse (Breo). That is very shocking information for any parent to hear. The industry denies that these symbols target people under 21 and claim that their advertising goal is simply to promote brand switching and loyalty. Many people disagree with this statement such as Illinois Rep. Richard Durbin who states If we can reduce the number of young smokers, the tobacco companies will be in trouble and they know it (Roberts). So what do the tobacco companies do to keep their industry alive and well? Seemingly, they go toward a market that is not fully aware of the harm that cigarettes are capable of. U.S. News recently featured a discussion of the smoking issue with 20 teenagers from suburban Baltimore. The group consiste d of ten boys and ten girls between the ages of 15 and 17. When asked why they started smoking, they gave two contradictory reasons: They wanted to be a part of a peer group. They also wanted to reach out and rebel at the same time. When you party, 75 to 90 percent of the kids are smoking. It makes you feel like you belong, says Devon Harris, a senior at Woodlawn High. Teens also think of smoking as a sign of independence. The more authority figures tell them not to smoke, the more likely they are to pick up the habit (Roberts). The surprising thing is that these kids know that they are being influenced bycigarette advertising. If these kids know that this advertising is manipulating them, why do they still keep smoking? The ads are everywhere, especially in teen-oriented magazines, such as Rolling Stone and Spin. The ads also fuel some of the reasons the children gave for starting. They represent rebellion, independence, acceptance and happiness. These are all the things a young p erson, between childhood and adolescence, needs and desires. This type of advertising, on top of peer pressure, is the mystery behind therise in adolescent smoking. How do we stop the future of America from smoking? Here are three things that the experts recommend. Try to convince your children that smoking is not cool. Talk to your kids at a young age about the dangers of smoking. Identify family members who smoke and ask them to stop (Thomas). Children are the most valuable commodity we are given in life. Lets try to educate them while theyre young to be independent thinkers and to not be swayed by the tobacco companies who are trying to take advantage of their mind and body. Works CitedBill Clinton vs. Joe Camel. U.S. News World Report. 2 Sep. 1996: 12. Infotrac. Online. 27 Oct. 1996. .u21a764785db7955e86cff04ca0aa40b0 , .u21a764785db7955e86cff04ca0aa40b0 .postImageUrl , .u21a764785db7955e86cff04ca0aa40b0 .centered-text-area { min-height: 80px; position: relative; } .u21a764785db7955e86cff04ca0aa40b0 , .u21a764785db7955e86cff04ca0aa40b0:hover , .u21a764785db7955e86cff04ca0aa40b0:visited , .u21a764785db7955e86cff04ca0aa40b0:active { border:0!important; } .u21a764785db7955e86cff04ca0aa40b0 .clearfix:after { content: ""; display: table; clear: both; } .u21a764785db7955e86cff04ca0aa40b0 { display: block; transition: background-color 250ms; webkit-transition: background-color 250ms; width: 100%; opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #95A5A6; } .u21a764785db7955e86cff04ca0aa40b0:active , .u21a764785db7955e86cff04ca0aa40b0:hover { opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #2C3E50; } .u21a764785db7955e86cff04ca0aa40b0 .centered-text-area { width: 100%; position: relative ; } .u21a764785db7955e86cff04ca0aa40b0 .ctaText { border-bottom: 0 solid #fff; color: #2980B9; font-size: 16px; font-weight: bold; margin: 0; padding: 0; text-decoration: underline; } .u21a764785db7955e86cff04ca0aa40b0 .postTitle { color: #FFFFFF; font-size: 16px; font-weight: 600; margin: 0; padding: 0; width: 100%; } .u21a764785db7955e86cff04ca0aa40b0 .ctaButton { background-color: #7F8C8D!important; color: #2980B9; border: none; border-radius: 3px; box-shadow: none; font-size: 14px; font-weight: bold; line-height: 26px; moz-border-radius: 3px; text-align: center; text-decoration: none; text-shadow: none; width: 80px; min-height: 80px; background: url(https://artscolumbia.org/wp-content/plugins/intelly-related-posts/assets/images/simple-arrow.png)no-repeat; position: absolute; right: 0; top: 0; } .u21a764785db7955e86cff04ca0aa40b0:hover .ctaButton { background-color: #34495E!important; } .u21a764785db7955e86cff04ca0aa40b0 .centered-text { display: table; height: 80px; padding-left : 18px; top: 0; } .u21a764785db7955e86cff04ca0aa40b0 .u21a764785db7955e86cff04ca0aa40b0-content { display: table-cell; margin: 0; padding: 0; padding-right: 108px; position: relative; vertical-align: middle; width: 100%; } .u21a764785db7955e86cff04ca0aa40b0:after { content: ""; display: block; clear: both; } READ: Blance DuBois Essay We will write a custom essay on Tobacco And Kids specifically for you for only $16.38 $13.9/page Order now Selling Tobacco to Kids. America. 17 Feb. 1996: 3. Infotrac. Online. 27 Oct. 1996. Roberts, Steven. Teens on tobacco; kids smoke for reasons all their own. U.S. News World Report. 18 Apr. 1996: 38. Infotrac. Online. 27 Oct. 1996. Thomas, Roger E. 10 steps to keep the children in your practicenonsmokers. American Family Physician. Aug. 1996: 450. Infotrac. Online. 27 Oct. 1996. Breo, Dennis L. Kicking Butts-AMA, Joe Camel and the Black Flag war on tobacco. JAMA, The Journal of the American Medical Association. 29 Oct. 1993: 1978. Infotrac. Online. 27 Oct. 1996.

Alcohol

Alcohol has been around for over 8000 years, Archaeologists have found that by 6400 B.C. people had discovers how to make alcohol in the form of Beer and Berry Wine. The distillation process where fermented solution containing alcohol was heated and the vapours collected and condensed into liquid to create spirits have been believed to be discovered in Arabia. Egyptians, Hebrews, Greeks and Roman leaders were all notorious for their drinking habits. By the 1500s distillation of whiskey was common in Ireland. It was also reported that the people Columbus met in the Caribbean had their own Beer. People have proved that society needs alcohol. All attempts to suppress alcohol in Europe and America have failed, and in the US alcohol consumption actually increased during Prohibition period. Today Ethyl alcohol is the effective chemical in the millions of different alcoholic products available on the market. People usually start drinking between 13-14 years of age on weekends or at social events. As they get older they tend to drink more, at age 13, 40% of teens claim to be nondrinkers but by the time they reach 18 the total is reduced to 10%. Teenagers start to drink for many reasons: 1) Experimentation- Curiosity to feel the effects that they hear from others. 2) Peer Pressure- Usually teens reject an individual who doesnt drink; there are also pressures from the culture they grow up in. 3) Adolescent Adjustment Problems- During adolescents so many changes occur that creates stress, feelings of depression, confusion, disorganization and helplessness. By drinking the teen is able to feel a false sense of normality. 4) Family Life Adjustment Style- Family problems or accidents have put many teenagers into abuse of alcohol. Events like divorce, death of a family member especially a parent or family conflicts. The teen uses alcohol to push these problems aside.

Case Study Assignment Example | Topics and Well Written Essays - 500 words - 7

Case Study - Assignment Example It was perfectly clear that they were condoning the act and prioritized their misguided need for Sandusky’s services over those of little children that had suffered under his care. It is more likely that those in charge AD and VP were more concerned with building the culprits name at the expenses of innocent children who were suffering in the hands of someone that was being portrayed as a provider. All these were part of the ethical failures that made this case all those years, for a serious action to be taken. The most likely trigger for the unethical behavior was Sandusky’s ‘good’ gesture of opening a charity â€Å"Second Mile†. Apparently, he ended up suing the charity as a grooming haven for his victims. Those in power, the police incompetence, the AD and VP were also key in building this culture (Gill Jr. and Allen). The most notable thing to do by those who had prior knowledge of these allegations should have reported to the police and assist in the investigation to provide sufficient evidence to convict Sandusky. The sanctions against PSU were a bit harsh considering the fact that many suffered for the crime of a few. Loss of scholarships, the heavy fine, and vacating PSU victories, brought more damage to the innocent than the perpetrators. Gill Jr., E. L., and T. Allen. â€Å"The Sandusky Child Sexual Abuse Scandal: The Implications for Athletic Department Procedures, Training, Policy, and Child Welfare System Interactions.† Journal of Issues in Intercollegiate Athletics (2013): 70–89. Print. Great post Christiana, I agree with you on the fact that Sandusky’s unethical desires were the brainchild of all these mayhem. Not only did he abuse his power, but also he repeatedly abused the children that he was in charge of protecting and nurturing. Perjury in this case was what fueled Sandusky’s actions as he knew he was untouchable probably

Reflective learning log Essay Example | Topics and Well Written Essays - 2000 words

Reflective learning log - Essay Example 62). The first part of the article talks about how to put culture into context and is largely based on the work created by Geert Hofstede, described as a "Dutch academic". Hofstede believed that culture is "learned and not inherited" and that it is "somewhere between an individuals unique personality and human nature" (p. 63). Hofstede saw that there were several layers where culture is related to other people in a "mental programming activity". He describes the inner layer as the organization where an individual works, and an outer layer that is the countries or country where an individual lives or has lived. These factors create the first aspects of how people will get along in a leadership capacity. Social class, gender, age, ethnicity and religion are factors that will influence leadership in addition to the others. From this standpoint, the chapter begins to define "organizational culture" and how peel are more apt to define this as "the way we do things around here." (p. 64). There are several theories within this process. Schien suggests that leadership is responsible for the creation, management and sometimes destruction of organizational culture (p. 65). This section of the chapter describes how organizational culture is molded and shaped by different leaders as they also explore culture in the context of what Hofstede sees culture and they attempt to merge the two. The next part of the chapter explores the concept of how organizational culture relates to individuals versus groups in lieu of their own ethnic culture. They begin with a study of individualism and collectivism that explains the difference between groups who only are concerned with the individual versus those who are more socially oriented. They suggest that they way that these two differ may be due to how an individual or group perceives

The Diverse Lifestyle Of London Essay Example | Topics and Well Written Essays - 1000 words

The Diverse Lifestyle Of London - Essay Example It was a long travel from the airport to my cousins at Victoria. I was over excited about visiting London and to look around the places. I just couldn’t wait. My mum and dad were trying hard to explain to me that it would not be too good for us to leave immediately as it would not be the right etiquette. I did not realize and went on to fight with my parents and even be really rude and say that I was not interested in the wedding anniversary of my aunt and uncle. This conversation was overheard by my aunt, a very sweet and kind-hearted lady, who was in shock and could not believe that I was saying something like this. We started a tour the same day and managed to see some exciting places like the London Bridge, Madame Tussauds, The London Eye, several different museums in London, Big Ben, and Hampstead Heath on the first day. With this, we thought we had covered to the whole of London and were wondering what we would do for the rest of the week. To our surprise, there was so m uch more to see in London and what we had seen was just a small part of the city. The next day went by with the celebrations and we met our distant relatives after years, and a few I was meeting for the first time in life. Little did I realize that my aunt had been very hurt and was unable to enjoy the party and although she was there she had a smile fixed to her face which was very clearly not one that seemed happy. Unknowingly, I had ruined the best day of my aunt’s life and had hurt here quite a bit.

Epigenetic Control of Endocannabinoid Function

Epigenetic Control of Endocannabinoid Function Janis Szeremeta Epigenetic control of endocannabinoid function Prostate cancer is one of the most frequently diagnosed types of tumours in the male population worldwide. The endocannabinoid system, more specifically high expression of cannabinoid receptor 1 (CB1) in tumour tissue, has been associated with poor prognosis in prostate cancer and suggested as a prognostic marker. Epigenetic silencing has previously been shown to upregulate CB1 mRNA expression in colon cancer cell lines and to induce expression of normally silenced cannabinoid receptor 2 (CB2) mRNA in a neuroblastoma cell line. In the present study, potential effects of epigenetic modulation on the expression of 12 different components of the endocannabinoid system (receptors, synthetic and catabolic enzymes) were investigated in a prostate cancer and a neuroblastoma cell line. Additionally, two catabolic pathways were investigated in functional assays. In general, changes in mRNA expression levels produced by treatment with the epigenetic modulators, 5-aza-2-deoxycytidine and Tricho statin A were small, and, in the case of the catabolic enzyme fatty acid amide hydrolase in DU-145 prostate cancer cells were not accompanied by observable changes in hydrolysis rates. In SH-SY5Y neuroblastoma cells a low expression of monoacylglycerol lipase was found and this was also observed in functional assays. It is concluded that for the cell lines investigated, the epigenetic modulators tested do not modify the endocannabinoid system to any obvious degree, at least at the mRNA level. Since these experiments were conducted on a single cell line of a specific cell type only, introduction of alternative prostate cancer cell lines, such as PC-3 or LNCaP, might have different outcomes and should be considered for future experiments. Due to its involvement in a variety of physiological and pathophysiological conditions, such as obesity, pain, immunomodulation and cancer1, the endocannabinoid system has emerged as an important area of research. Endogenous lipid transmitters, the so-called endocannabinoids, act by binding and activating the G-protein coupled cannabinoid receptors 1 and 2 (CB1/ CB2). Endocannabinoid levels are tightly regulated by a network of synthesizing and catabolizing enzymes (Figure 1). Two lipid mediators, N-arachidonoylethanolamine (anandamide, AEA) and 2-arachidonoylglycerol (2-AG), remain the most thoroughly studied endocannabinoids to date. 2-AG is derived from hydrolysis of diacylglycerols (DAGs) containing arachidonic acid via diacylglycerol lipases ÃŽÂ ± and ÃŽÂ ² (DGLÃŽÂ ±/ÃŽÂ ²) and then hydrolysed to arachidonic acid mainly via monoacylglycerol lipase (MGL) but also by ÃŽÂ ±/ÃŽÂ ²-hydrolase domain containing 6 and 12 (ABHD6, ABHD12)2. AEA is derived from N-acylphos phatidylethanolamines (NAPEs) by hydrolysis via NAPE-phospholipase D (NAPE-PLD). It is inactivated by hydrolysis via fatty acid amide hydrolase (FAAH) and N-acylethanolamine acid amide hydrolase (NAAA) to arachidonic acid. Arachidonic acid is a substrate for many enzymes, including cyclooxygenase (COX) -1 and -2, 5- and 12-lipoxygenases (5/12-LOX) to produce prostaglandins, 5- and 12- hydroxyicosatetraenoic acid (5/12-HETE), respectively. Both 2-AG and AEA can also be hydrolysed to prostaglandin H2 derivatives via COX-23. Current modulators of the endocannabinoid system include a variety of selective pharmacological inhibitors for these enzymes which can be used to study their functional roles in the body (see Figure 1 for compounds used in this study). Figure 1: Simplified view of the endocannabinoid system. G-protein coupled receptors CB1 and CB2 are activated by lipid mediators, in this case 2-AG and anandamide (AEA) as well as by plant derived and synthetic compounds (not depicted). 2-AG and AEA are synthesized from diacylglycerol or N-acylphosphatidylethanolamine precursors and act locally. Both messengers are hydrolysed to arachidonic acid and/or prostaglandin H2 derivatives. Descriptions given in green were investigated towards changes in mRNA expression following epigenetic modulation treatment. Descriptions given in red show endocannabinoid metabolizing enzyme inhibitors. Abbreviations: Penta, Pentadecylamine (after Muccioli 20103). The endocannabinoid system is becoming a more and more important therapeutic target in cancer, and very interestingly, different types of cancer appear to react differently to changes in endocannabinoid balance, with oftentimes opposing effects ranging for example from pro- to antiapoptotic4. This shows why understanding how the endocannabinoid system is regulated in health and disease remains an important part of research. An important hallmark of cancer formation of cancer is the occurrence of epigenetic alterations5,6. Aberrant DNA methylation has been found in various types of cancer and effects vary between hyper- and hypomethylation states and in different types of cancer (see Kulis et al 20107). DNA methylation is usually associated with inhibition of gene expression. Cytosine nucleotides are methylated at the fifth carbon to form 5-methylcytosine, which can hinder transcription factor binding and therefore interfere with gene expression8. 5-Aza-2-deoxycytidine is a DNA demethylation compound that is able to replace and mimic cytosine in the DNA. In case of a cytosine replacement, DNA methyltransferases (DNMTs), that would normally catalyse methylation of cytosines, will now be bound covalently to 5-Aza-2-deoxycytidine, leading to degradation and depletion of DNMT protein levels and therefore a decrease of DNA methylation9. Note that this process is unspecific and generally decreases overall DNA methylation. Histone acetylation, a different type of epigenetic modification, is associated with activation of gene transcription. Occurring on lysine residues of histones, histone acetylation is associated with a charge neutralization of the positively charged histone molecules. This neutralization reaction is thought to decrease interaction between negatively charged DNA phosphate backbones and their positively charged histone counterparts, therefore increasing DNA availability10. Histone acetylation is regulated by an interplay of histone acetylases (HATs) and histone deacetylases (HDACs)11. Inhibition of HDACs may be used to constitutively activate histone acetylation mediated gene expression. Prostate cancer has become one of the most frequently diagnosed malignancies in men throughout Europe12. Current evidence suggests that high a CB1 receptor immunoreactivity is correlated to disease severity and outcome13. Several prostate cancer cell lines and human prostate cancer tissues have been shown to express CB1 receptors using various techniques, such as qPCR, immunofluorescence and western blotting13-16. There is evidence that CB1 expression is regulated epigenetically in colorectal cancer, where DNA hypermethylation lead to a loss of CB1 expression17. The same study found inhibition of epigenetic silencing (i.e. removal of DNA methylation) increased Cnr1 mRNA expression in seven out of eight colorectal cancer cell lines. A different study investigated the effects of two different epigenetic modulators, 5-Aza-2-deoxycytidine (Aza dC) and Trichostatin A (TSA), a histone deacetylase inhibitor, upon CB receptor expression in two different cell lines18. Inhibition of epigenetic silencing in Jurkat T cells increased Cnr1 mRNA expression in an additive manner but did not affect Cnr2 mRNA expression, whereas treatment of human SH-SY5Y neuroblastoma cells lead to induction of normally silenced Cnr2 mRNA expression, again in an additive manner, but no changes in Cnr1 mRNA. Whilst the above data implicate epigenetic regulation of CB receptors, it is not known whether it is seen in prostate cancer cells, and there is no data concerning the endocannabinoid synthetic and catabolic enzymes. In consequence, the present study investigated the effects of Aza dC and Trichostatin A treatment upon mRNA expression for 12 different endocannabinoid-related genes (see Figure 1). Differences that were found were investigated in hydrolysis experiments and changes in either AEA or 2-AG hydrolysis. In addition, since tumours are often located in hypoxic microenvironments19, cell lines were exposed to hypoxic conditions for increasing intervals up to 24 h and the same panel of endocannabinoid system components was investigated towards mRNA expression. Cells were either placed into anoxic incubation chambers or exposed to hypoxia mimetics such as Co(II)Cl220 or deferoxamine21. Drugs and Compounds Radiolabeled compounds ([3H]-2-OG (60 Ci/mmol)), [3H]-AEA (60 Ci/mmol)) were obtained from American Radiolabeled Chemicals Inc, St. Louis, MO, USA. URB597, JZL184, WWL70 were obtained from the Cayman Chemical Co. (Ann Arbor, MI, USA). Pentadecylamine, 5-Aza-2-deoxycytidine (Aza dC), Trichostatin A, Co(II)Cl2 were obtained from Sigma-Aldrich (St. Louis, MO, USA). Cell Culture Human DU-145 (prostate cancer, passage range 17 to 29) and SH-SY5Y (neuroblastoma, passage range 19 to 28) cells were expanded in Eagles Minimal Essential Medium (EMEM ATCC 30-2003) supplemented with penicillin, streptomycin (10,000 U/mL each, Gibco by Life Technologies) and 10% FBS (Gibco by Life Technologies) in 75 mL flasks at 37ËÅ ¡C with 5% atmospheric CO2. Cells were plated in 24 well plates with a total number of cells of 1.5 ÃÆ'- 105 for DU-145 and 2.5 ÃÆ'- 105 cells for SH-SY5Y per well overnight. Epigenetic Modulation using 5-Aza-2-deoxycytidine and Trichostatin A Following the overnight plating, DU-145 and SH-SY5Y cells were treated by replacing the old medium with a fresh layer of medium containing Aza dC (1  µM), Trichostatin A (25 nm), a combination of both, or vehicle (DMSO 0.1%) as control for 24 h. After 24 h hours, cells were lysed according to the Dynabeads ® mRNA DIRECT„ ¢ Purification Kit (Thermo Fisher Scientific, Waltham, MA, USA) instructions and mRNA was extracted. Exposure to Hypoxia/Hypoxia Mimetics Induction of hypoxia was achieved via two different methods. Cells were seeded into 24 well plates and either kept in a hypoxic environment or were exposed to the hypoxia mimetic Co(II)Cl2. A hypoxic atmosphere inside an airtight modular incubation chamber (Billups Rothenberg Inc, San Diego, CA, USA) was achieved by first flushing the medium with a hypoxic gas mix (1% O2, 99% CO2) at a rate of 3 L/min for 5 minutes. The old medium was replaced with a layer of flushed medium and plates were placed into the airtight chamber. The chamber was flushed with hypoxic gas at a rate of 20 L/min for 5 minutes (per manufacturers instructions22) and then incubated at 37ËÅ ¡C for either 2, 4, 6, 8 or 24 h. Co(II)Cl2 was used at a final concentration of 50 mM and cells were incubated for 2, 4, 6, 8 or 24 h. HIF1ÃŽÂ ± and HIF2ÃŽÂ ± mRNA levels were assessed for both procedures to evaluate induction of hypoxia. qPCR mRNA was extracted using the Dynabeads ® mRNA DIRECT„ ¢ Purification Kit. mRNA (5  µg of total) was used for reverse transcription using the High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems, Thermo Fisher Scientific). qPCR reaction mixtures were prepared using the KAPA SYBR FAST qPCR Master Mix (2X, KAPA Biosystems, Wilmington, MA, USA) to a final Volume of 20  µL. Reactions were run on the Illumina Eco Real Time PCR system (Illumina Inc, San Diego, CA, USA) with an initial denaturation time of 10 minutes at 95ËÅ ¡C, 45 cycles of 10 seconds at 95ËÅ ¡C and 30 seconds at 60ËÅ ¡C and melting curve cycle times of 15 seconds at 95ËÅ ¡C, 15 seconds at 55ËÅ ¡C and a final step of 95ËÅ ¡C for an additional 15 seconds. Primers (Table 1) were synthesized at Integrated DNA Technologies (Coralville, IA, USA). Amounts of transcripts were normalized to ribosomal protein L19 (RPL19) and relative quantification was perf ormed using the ˆâ€  Ã‹â€ Ã¢â‚¬  Ct method. Table 1: primers used for qPCR experiments Gene Product Forward primer (5 to 3) Reverse primer (5 to 3) Abhd6 ABHD6 GATGTCCGCATCCCTCATAAC CCAGCACCTGGTCTTGTTTC Abhd12 ABHD12 GGCAGAAAGCTCTATAGCATCG CCTGTAGCCAAGGTCTGAATG Cnr1 CB1 CACCTTCCGCACCATCACCAC GTCTCCCGCAGTCATCTTCTCTTG Cnr2 CB2 1st pair CATGGAGGAATGCTGGGTGAC GAGGAAGGCGATGAACAGGAG CB2 2nd pair AAACAACTGGGACTCCTC GTCTAGAAGGCTTTGGGTTG Ptgs2 COX-2 AGCAGGCAGATGAAATACCAG ACCAGAAGGGCAGGATACA Dagla DAGLÃŽÂ ± CCCAAATGGCGGATCATCG GGCTGAGAGGGCTATAGTTAGG Daglb DAGLÃŽÂ ² TCAGGTGCTACGCCTTCTC TCACACTGAGCCTGGGAATC Faah FAAH CACACGCTGGTTCCCTTCTT GGGTCCACGAAATCACCTTTGA Hif1a HIF1ÃŽÂ ± GCTGATTTGTGAACCCATTCC TTCATATCCAGGCTGTGTCG Epas1 HIF2ÃŽÂ ± CACAGAGTTCTTGGGAGCAG ACCCTTTGCAGACCTTGTC Alox5 5-LOX ATCCAGCTCAACCAAATCCC ACCAGATGTGTTCGCAGAAG Alox12 12-LOX GATCCGAGGAGAGAAGCAATAC GGAGGCTGAATCTGGATGAC Alox15 15-LOX CGAGGGTTTCCTGTCTCTTTAC GCACCCAAGAGTACCAGTC Mgll MAGL GGAAACAGGACCTGAAGACC ACTGTCCGTCTGCATTGAC Naaa NAAA ATGGAGCGTGGTTCCGAGTT AGGCTGAGGTTTGCTTGTCCT Napepld NAPE-PLD ACTGGTTATTGCCCTGCTTT AATCCTTACAGCTTCTTCTGGG Rpl19 RPL19 CACATCCACAAGCTGAAGGCA CTTGCGTGCTTCCTTGGTCT [3H]-AEA Hydrolysis in DU-145 Cells The assay of Bjà ¶rklund et al. (2014)23 was used. Cells (1.5 ÃÆ'- 105 per well) were plated and kept overnight to allow for cell adherence. Subsequently, cells were treated with Aza dC (1  µM) for 24 h or left untreated as control. Non-enzymatic hydrolysis was measured in non-cell containing wells. Wells were washed with KRH buffer (120 mM NaCl, 4.7 mM KCl, 2.2 mM CaCl2.2H2O, 10 mM HEPES, 0.12 mM KH2PO4, 0.12 mM MgSO4 containing 1% BSA (Sigma Aldrich) followed by KRH buffer alone. KRH buffer containing 0.1% fatty-acid free BSA (Sigma Aldrich) was added to the wells and plates were kept in a water bath at 37ËÅ ¡C. Inhibitors (URB597 1  µM, Pentadecylamine 1  µM, URB597 and Pentadecylamine 1 µM each) or vehicle (DMSO 0.1%) were added and plates incubated for 10 minutes at 37ËÅ ¡C. [3H]-AEA (diluted with non-radioactive AEA to give a final assay concentration of 0.5  µM) was added and plates were incubated for a further 15 minutes resulting in a total reaction vol ume of 400  µL. The hydrolysis reaction was stopped by adding 600  µL activated charcoal in 0.5 M hydrochloric acid and plates were kept on ice. Charcoal and aqueous phase were separated by centrifugation (2,500 rpm, 10 min.), 200  µL of the aqueous phase were recovered and mixed with 4 mL scintillation liquid (ULTIMA GOLD, PerkinElmer) for liquid scintillation radioactivity determination with quench correction. The [3H]-AEA used is labelled in the ethanolamine part of the molecule, and the [3H]-ethanolamine produced by the hydrolysis of [3H]-AEA does not adsorb to the charcoal, whereas the [3H]-AEA does adsorb24. [3H]-2-OG Hydrolysis in SH-SY5Y Cells Cells (2.5 ÃÆ'- 105 per well) were plated and incubated overnight to allow for cell adherence. Non-enzymatic hydrolysis was measured in non-cell containing wells. The assay used was the same as for [3H]-AEA hydrolysis, but using 0.5  µM [3H]-2-OG (labelled in the glycerol part of the molecule). Inhibitors (URB597 1  µM, JZL184 1  µM, WWL70 10  µM, a combination of URB597, JZL184 and WWL70 and a combination of JZL184 and WWL70 at the aforementioned concentrations) or vehicle (DMSO 0.1%) were added and plates incubated for 10 minutes at 37ËÅ ¡C followed by addition of substrate and incubation for a further 15 min. See above for determination of radioactivity in aqueous phase. Cytotoxicity Assessment/Assay To determine the cytotoxicity of the various treatments throughout this project the LDH cytotoxicity detection kit from Roche (Cat. No. 11 644 793 001) was used per manufacturers protocol. Statistical Analyses Statistical analyses were undertaken by my Supervisor using the function ezANOVA in the package ez for the R statistical programme (R Core Team, URL http://www.R-project.org/). The details and the command lines used are given in Table 2. Epigenetic regulation of endocannabinoid function DU-145 and SH-SY5Y cells were treated for 24h with either Aza dC, TSA or a combination of both compounds, after which mRNA was extracted and analused for expression of marker of the endocannabinoid system. Table 2 shows the summarized data of the statistical analysis obtained in the gene expression studies. Main effects are given in the left half of the table. Significant differences were found for a various number of genes and are given in bold type. Main effects cell describes the comparison of gene expression between DU-145 and SH-SY5Y cells. The columns with Aza dC and TSA describe the effect of the epigenetic modulators on mRNA expression of the gene of interest and only a few of them were statistically significant (i.e. DGLÃŽÂ ² and FAAH for Aza dC and 12-LOX for TSA). Interpretation of the main effects is difficult when there are significant interactions. Values in bold type indicate an interaction between components) for four of the twelve genes of interest. In these cases, individual two-way ANOVAs helped to determine actual differences for each cell line per se. Results of these ANOVAs can be found below their corresponding figures (see Figure 2, Figure 3 and Figure 4) with a P Table 2: Three-way ANOVA summary for the PCR data. Main effects Interactions Cell: Cell: Cell: Aza dC: Aza dC: Protein Cell Aza dC TSA Aza dC TSA TSA TSA CB1 0.0003 0.31 0.060 0.38 0.89 0.14 0.30 NAPE-PLD 0.34 0.40 0.28 0.0093 0.29 0.29 0.54 DGLÃŽÂ ± 0.87 0.88 0.0049 0.49 0.16 0.61 DGLÃŽÂ ² 0.43 0.0004 0.027 0.020 0.031 0.88 0.96 FAAH 0.041 0.0061 0.55 0.17 0.85 NAAA 0.012 0.53 0.44 0.79 0.15 0.40 MGL 0.21 0.019 0.014 0.85 0.25 0.59 ABHD6 0.0004 0.019 0.15 0.0001 0.70 0.43 0.67 ABHD12 0.0078 0.014 0.65 0.091 0.14 0.61 0.11 COX2 0.032 0.62 0.21 0.70 0.83 0.74 5-LOX 0.99 0.45 0.21 0.91 0.98 0.13 0.53 12-LOX 0.0039 0.18 0.0001 0.41 0.55 0.93 0.69 Data shows the ANOVA p values for each protein, calculated for the data expressed as ˆâ€  Ct using the function ezANOVA in the package ez for the R statistical programme. The command line used was Model25). P values in bold type are those where significance remained after implementation of a 5% false discovery rate (Benjamini Hochberg, 199526). When the interaction cell type x Aza dC was significant, two-way ANOVA matching for Aza dC and TSA have been calculated for each cell type separately, and these are shown in the figures. Note that for DGLÃŽÂ ² and MGL the variances were different for the DU145 and SH-SY5Y cells and this will affect accuracy of the P values. In these cases, the cells have been analysed separately and the ANOVA values given in the figures. Cannabinoid receptors 1 and 2 Figure 2: Panel A, mRNA levels for CB1 receptors in DU145 and SH-SY5Y cells treated with Aza dC and/or TSA. The graphs show the individual ˆâ€  Ct values (bars show the means), N=6 per group (each assayed in triplicate), with the corresponding % of controls on the right column. For statistical treatment, see Table 2. Panel B, melting curves for the primers used for CB1 and CB2 receptors. The melting curves are for the DU145 cells. Gene expression analysis data of CB1 mRNA is given in Figure 2A. Expression rates were significantly different between the two cell lines, but neither Aza dC nor Trichostatin A had an effect. No interactions between the compounds and the cell types were found (Table 2) Unfortunately, two different primer pairs, designed to amplify Cnr2 mRNA did not give detectable and reproducible mRNA expression of CB2, so no expression data could be obtained for CB2 (Figure 1B). The first primer pair was taken from a previous publication by Bà ¶rner et al whereas the second pair was designed on site. Figure 1B shows the different melting curves obtained during the qPCR assays for DU-145, with similar results for SH-SY5Y cells. Endocannabinoid synthetic enzymes Figure 3: mRNA levels of the endocannabinoid synthetic enzymes NAPE-PLD (A), DGLÃŽÂ ± (B) and DGLÃŽÂ ² (C). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panels A and B) or when the variance was different for the two cell types (Panel C). Effects of epigenetic modulation on the expression of endocannabinoid synthetic enzymes are shown in Figure 2. No main effects of either Aza dC or TSA were detected for NAPE-PLD or DGLÃŽÂ ±, there was an interaction between the different cell types and the Aza dC treatment, however (see Table 2). For these samples a two-way ANOVA was calculated and values are given below each figure. Indiviual treatments did not have any significant effect on the expression of both NAPE-PLD and DGLÃŽÂ ± (Figure 2A and B), an additive effect of Aza dC and TSA could be observed for the expression of DGLÃŽÂ ± in DU-145 cells, where expression decreased to a small degree. For DGLÃŽÂ ², since the variance was different for both cell types, a two-way ANOVA was calculated for each. No significant effects were observed for DGLÃŽÂ ² expression in SH-SY5Y cells. However, both Aza dC and TSA had significant main effects in the DU-145 cells, although the sizes of the changes produced by the compou nds were very small (Figure 2C). AEA catabolic enzymes Figure 4: mRNA levels of the endocannabinoid catabolic enzymes FAAH (A) and NAAA (B). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panel A). As seen in Table 2, Aza dC had both a significant main effect, but also displayed interaction between the cell types and the compound for FAAH. The two-way ANOVA for FAAH resulted in significant differences only for the Aza dC treatment in DU-145, but not in SH-SY5Y. Once again, the effects were very small in size. Trichsotatin A did not have an effect in either cell line, neither individually nor in combination (Figure 3A). No significant differences were found for NAAA (Figure 3B). 2-AG catabolic enzymes Figure 5: mRNA levels of the endocannabinoid catabolic enzymes MGL (A), ABHD6 (B) and ABHD12 (C). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panel B) or when the variance was different for the two cell types (Panel A). Gene expression analysis of the three key enzym

Earnest Hemingway Essay -- essays research papers fc

Earnest Hemingway As one of the 20th century's most important and influential writers. His writings drew heavily on his own experiences for his writing. His writing reflected his trouble with relating to women and his tendency to treat them as objects, as he had four marriages and countless affairs, highlighting his theme of alienation and disconnection. Now here is why he is what he is by writing about what he was. Ernest Miller Hemingway was born on July 21, 1899, in Oak Park, Illinois, to Dr. Clarence Hemingway and Grace Hall Hemingway. Oak Park was a mainly Protestant, upper middle-class suburb of Chicago that Hemingway would later refer to as a â€Å"town of wide lawns and narrow minds" (Gerogiannis 188). The second among six children, Ernest spent the first two years of his life dressed as a girl by his mother. She called him â€Å"Ernestine† and fantasized that he was the twin of his older sister, as she dressed them both in matching dresses and gave them similar hairstyles (Rozkis 233) As he grew older, however, his father stepped in and insisted that Ernest be â€Å"raised like a man,† teaching Ernest how to behave and introducing him at a young age to hunting, fishing, and boxing, all activities in which he would stay interested for the rest of his life (Gerogiannis) It is perhaps this early start at questioning his manliness and his father’s attempts to drive any femininity out of him that instilled his characteristic obsession with proving his masculinity throughout his life. Schlusemeyer 2 Hemingway received his schooling in the Oak Park public school system. In high school he was mediocre at sports, joining the football, swimming, basketball, and water polo teams and serving as the track team manager (Nelson 5). He began his journalistic career writing for the school paper, the Trapeze, where he wrote his first articles and often humorous pieces in the style of Ring Lardner, a popular satirist of the time. After graduating in the spring of 1917, against the wishes of his parents, he forwent college and took a job as a cub reporter for the Kansas City Star. It is here that the seeds of his unmistakable staccato writing style were planted as he followed the rules of the Star’s stylebook exactly. â€Å"Use short sentences,† it said. â€Å"Use shor... ...Modified August, 1999. Viewed April 20, 2005. http://www.ernest.hemingway.com Ernest Hemingway in Oak Park, Illinois Last Modified 2004. Viewed April 21, 2005. http://www.ehfop.org Gerogiannis, Nicholas. "Ernest Hemingway." Dictionary of Literary Biography: American Authors in Paris. Vol. 4. Detroit: Gale, 1982. 187-211. Meyers, Jeffrey. Hemingway: A Biography. New York: Harper & Row, 1985. Nelson, Raymond S. Ernest Hemingway: Life, Work, and Criticism. Fredericton, N.B., Canada: York Press, 1984. Picturing Hemingway: A Writer in His Time Last Modified January, 1998. Viewed April 21, 2005. http://www.npg.si.edu/exh/hemingway/index.htm Rozkis, Laurie E. Macho, Macho Man: Ernest Hemingway. New York: Pearson Press, 1999. The Ernest Hemingway Home & Museum Last Modified 2002. Viewed April 20, 2005. http://www.hemingwayhome.com Timeless Hemingway. Last Modified January, 2005. Viewed April 20, 2005. http://www.timelesshemingway.com